Data set title: 
PML Benthic Survey microbial gene abundance data from four sites (Jenny Cliff, Cawsand, Rame and L4) in the Western English Channel surveyed bimonthly from July 2008 to May 2011.

Name of data file(s):
microbe_gene_abundance_2008-2011.csv
microbe_gene_abundance_2008-2011.csv 

Data set creator(s) and institute(s):
Karen Tait, Plymouth Marine Laboratory

Data set period: 
2008-07-16 to 2011-05-19

Data set location:
Cawsand                 50° 19.81' N, 4° 11.50' W
L4                      50° 13.30' N, 4° 11.40' W
Rame                    50° 17.75' N, 4° 16.00' W
Jennycliff              50° 20.91' N, 4° 07.71' W

Data set abstract:
Microbial gene abundance data from surface sediment samples collected as part of the Western Channel Observatory (WCO).  DNA was extracted from surface sediment samples taken every two months from July 2008 to May 2011 from four sites with contrasting sediment characteristics and depth in the WCO. Two sites are muddy (Jenny Cliff and Rame) and two are have sandy sediments (Cawsand and L4). Jenny Cliff and Cawsand have water depths of 10 m, Rame is 45 m and L4 is 55 m deep. For four replicate sediment samples, abundance measurements of bacteria 16S rRNA genes, archaeal 16S rRNA genes, Planctomycete 16S rRNA genes, bacterial and archeal ammonia oxidising genes (amoA) and nitrite oxidizer genes (nirS) were made using quantitative PCR (pPCR). Both site and seasonal changes to the abundance of 16S rRNA and functional genes are apparent. 

Sampling methodology and description of analytical techniques:
Sediment samples were taken using a rosette multicorer. Overlying water was removed from the cores and surface sediment samples (1 ml) were taken using the barrel of a 2.5 ml syringe and stored at -20°C until further analysis. DNA was extracted from 0.5 g sediment using method described in Laverock et al. (2009).
Gene abundances were measured using quantitative PCR (qPCR) using an ABI 7000 sequence detection system (Applied Biosystems, Foster City, USA) and QuantiFast SYBR Green PCR Kit (Qiagen). For each sediment sample, 10 ng DNA was used to determine the abundance of archaeal and bacterial 16S rRNA genes, archaeal and bacterial ammonia oxidiser (amoA), nitrite reducer (nirS) genes and PCR primers specific for Planctomycete 16S rRNA were used as a proxy for anammox potential. The primer concentrations, annealing temperatures and cycle conditions are listed in below. Assays contained a standard curve containing 102 to 108 amplicons μl -1 DNA. DNA standard curves for each primer pair were constructed using cloned sequences. Gene and transcript numbers were quantified via comparison to standard curves using the ABI Prism 7000 detection software. Automatic analysis settings were used to determine the threshold cycle (CT) values and baselines settings. Each assay was preformed twice with similar results each time. The no-template controls were below the threshold in all experiments.


Target gene	Target organism			Primer pair	Primer sequence,5' - 3' nM primer 	AT (°C)	Amplicon length (bp)	Reference
16S rRNA	Bacteria			Bact 1369F	CGGTGAATACGTTCYCGG	300		60.0	123			Suzuki et al. 2000
						Prok 1492R	GGWTACCTTGTTACGACTT	900

16S rRNA	Archaea				Parch519F	CAGCCGCCGCGGTAA		300		63.0	396			Coolen et al. 2004
						ARC915R		GTGCTCCCCCGCCAATTCCT

amoA		Bacterial ammonia oxidisers	amoA1F		GGGGTTTCTACTGGTGGT	900		61.5	490			Stephen et al. 1996
						amoA2R		CCTCKGSAAAGCCTTCTTC							Hornek et al. 2006

amoA		Archaeal ammonia oxidisers	Arch-amoA-for	CTGAYTGGGCYTGGACATC	300		58.5	256			Wuchter et al. 2006
						Arch-amoA-rev	TTCTTCTTTGTTGCCCAGTA

16S rRNA	Planctomycetes			AMX 368F	TTCGCAATGCCCGAAAGG	900		59.0	452			Schimd et al. 2003
						AMX 820R	AAAYCCCTCTACTTAGTGCCC

nirS		Nitrite reducers		nirS1F		CCTAYTGGCCGCCRCART	900		62.0	256			Braker et al. 1998 
						nirS3R		GCCGCCGTCRTGVAGGAA

Primer pairs and reaction conditions used for q-PCR and RT-qPCR assays 

Data quality comments:
The author does not have any concerns over the quality of the data set and values are consistent with similar data reported in the wider literature.

Data usage:
It is essential for all users of these data to establish and maintain contact with the nominated current data originators as well as fully consulting the metadata. While not impinging on free data access, this ensures that this dataset is being used in the correct way, and any potential issues with the data are clarified. As more samples are identified, a proper dialogue with these local experts on the series may enable, where appropriate the most recent dataset to be used.