Marine and Freshwater Microbial Biodiversity (M&FMB)
Data submission
BODC deals with four main data types for M&FMB. Navigate the page by clicking on the following options
- Information for the M&FMB data set and resource catalogue
- Environmental data
- Genetic sequence data from environmental samples
- Gels from environmental samples
For any other data types please contact Gwen Moncoiffé at BODC.
For more general information, go to Submitting data to BODC.
1. Information for the M&FMB data set and resource catalogue
Please submit information about data collection activities, type of data or resource generated, methods used, and curation plans for the data, samples or cultures using the downloadable Excel spreadsheet. The form can also be used to describe non-fieldwork activities. Alternatively, the same level of information may be submitted using a format more appropriate to your type of work.
The information collated will be used to
- Generate a comprehensive inventory for the M&FMB programme.
- Identify data/material for inclusion on the M&FMB final CDROM product.
- Identify digital material in need of archiving at the end of the programme.
- Help us generate guidelines for the management of non-standard data.
2. Environmental data
When data analysis has been completed, please send a copy of your data
to BODC.
Data can be sent as attached files via email to
Gwen Moncoiffé.
We can accept most file formats providing the information they contain is easily accessible. Excel spreadsheets or ASCII file formats are the most commonly used for numerical data. TIF, GIF, JPEG or any other standard formats are preferable for image files. Tables or data embedded in Adobe PDF files are not acceptable. Please ask if you are unsure whether we can deal with your file format.
For environmental samples every measurement value should be linked to a sample with accurate reference to either a station number (for the AMBITION cruise) or to a date and time (referenced to UST) and space (latitude, longitude and depth or height including units and a reference point e.g. water surface, sediment surface).
Ensure that the following information is also provided
- Sampling mechanism (e.g. CTD rosette, air sampler, zooplankton net, non-toxic sample).
- Definition of any abbreviations, non-standard units and quality control symbols used.
- Formulas used to generate derived data.
- Primary data.
IMPORTANT — Please include (in Microsoft Word or text document)
- The name and institution of the data originator and the principal investigator.
- Specific details of sampling methods used.
- Specific details of any instruments used.
- Analytical procedures employed.
- Problems encountered/comments on data quality.
- List of associated data files.
3. Genetic sequence data from environmental samples
Genetic sequences should be submitted in a text file with relevant annotation for each sequence. An ideal format for this is
>Station10_25m_16SrDNA_cl.8 CGAAAGAAGGCCTTTGGCTGTCAAAGAGTAAACGcCTGaCGGAgCaA
TaCCCAGAGCTTAACGTGAGGTCTTTCAAGTCTGGCTACCTGAGGAA TAAGCTCAGGGAATGGGCGTAAAGCGTCCGCAGGTTCCGTGCCAGA TTCGCGTGAGGTGAACTGACGGTGCGGTAATACGGAGGATGCAAGC GTTTATCGGCTAACGCAGCCTATCCGGAATTATCTC >Station10_25m_16SrDNA_cl.9 GGAATGGGCGTAAAGCGTCCGGTGCGGTAATACGGAGGATGCAA etc... |
In this example, each annotation begins with a ">" to make it easy to automatically parse the information. The annotation also contains a site number, a depth measurement, the sequence type and a sample number.
Information required for each sequence is
- A geographical and temporal reference — ie coordinates and sampling time/date or a recognised site and cast number.
- The depth at which the sequence data were collected.
- A GenBank accession number if known.
- Sample source description as required for GenBank — ie scientific name if known, source modifiers (eg clone, strain, isolate), organelle from which any non-nuclear nucleotide sequence originates.
- Input DNA sequence as for GenBank— ie nucleotide sequence, type of molecule sequenced (genomic DNA, genomic RNA, mRNA, rDNA) and description of the sequence.
- Nucleotide sequence ID — the name you have given to this particular sequence.
- Details of any filters used.
- Release date information if you wish to keep the sequence confidential for a set period of time.
4. Gels from environmental samples
Please provide:
- A TIF image.
- Numerical interpretation if generated (presence/absence table).
- Separate file with relevant metadata and method information preferably in a spreadsheet style table linking each gel to detailed method and sample metadata information with time and space reference.
Related M&FMB pages at BODC
| Contents | Fieldwork programme | |
| Introduction | Data inventories | |
| Project overview | Data delivery | |
| BODC's role | Restricted access | |
| Data policy | Other links | |
| BODC processing |
Related external links
| Official M&FMB web site |
