Marine and Freshwater Microbial Biodiversity (M&FMB)

Data submission

BODC deals with four main data types for M&FMB. Navigate the page by clicking on the following options

  1. Information for the M&FMB data set and resource catalogue
  2. Environmental data
  3. Genetic sequence data from environmental samples
  4. Gels from environmental samples

For any other data types please contact Gwen Moncoiffé at BODC.

For more general information, go to Submitting data to BODC.

1. Information for the M&FMB data set and resource catalogue

Please submit information about data collection activities, type of data or resource generated, methods used, and curation plans for the data, samples or cultures using the downloadable Excel spreadsheet. The form can also be used to describe non-fieldwork activities. Alternatively, the same level of information may be submitted using a format more appropriate to your type of work.

The information collated will be used to

Go to the top of this page

2. Environmental data

When data analysis has been completed, please send a copy of your data to BODC.
Data can be sent as attached files via email to Gwen Moncoiffé.

We can accept most file formats providing the information they contain is easily accessible. Excel spreadsheets or ASCII file formats are the most commonly used for numerical data. TIF, GIF, JPEG or any other standard formats are preferable for image files. Tables or data embedded in Adobe PDF files are not acceptable. Please ask if you are unsure whether we can deal with your file format.

For environmental samples every measurement value should be linked to a sample with accurate reference to either a station number (for the AMBITION cruise) or to a date and time (referenced to UST) and space (latitude, longitude and depth or height including units and a reference point e.g. water surface, sediment surface).

Ensure that the following information is also provided

IMPORTANT — Please include (in Microsoft Word or text document)

Go to the top of this page

3. Genetic sequence data from environmental samples

Genetic sequences should be submitted in a text file with relevant annotation for each sequence. An ideal format for this is

>Station10_25m_16SrDNA_cl.8 CGAAAGAAGGCCTTTGGCTGTCAAAGAGTAAACGcCTGaCGGAgCaA TaCCCAGAGCTTAACGTGAGGTCTTTCAAGTCTGGCTACCTGAGGAA
TAAGCTCAGGGAATGGGCGTAAAGCGTCCGCAGGTTCCGTGCCAGA
TTCGCGTGAGGTGAACTGACGGTGCGGTAATACGGAGGATGCAAGC
GTTTATCGGCTAACGCAGCCTATCCGGAATTATCTC
>Station10_25m_16SrDNA_cl.9
GGAATGGGCGTAAAGCGTCCGGTGCGGTAATACGGAGGATGCAA
etc...

 

In this example, each annotation begins with a ">" to make it easy to automatically parse the information. The annotation also contains a site number, a depth measurement, the sequence type and a sample number.

Information required for each sequence is

Go to the top of this page

4. Gels from environmental samples

Please provide:


Related M&FMB pages at BODC

Contents     Fieldwork programme
Introduction     Data inventories
Project overview     Data delivery
BODC's role     Restricted access
Data policy     Other links
BODC processing  

 

Related external links

Official M&FMB web site